View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6058_low_4 (Length: 238)
Name: NF6058_low_4
Description: NF6058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6058_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 1553453 - 1553232
Alignment:
| Q |
1 |
ttataattaattctagaggaaagtggacttacgatccatcgagccattctgggtcgacgaggtttccaccaaatctaacaccagggatccatgacttctt |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1553453 |
ttataattaattctagaggtaagtggacttacgatccatcgagccattctgggtcgacgaggtttccaccaaatctaacaccagggatccatgacttctt |
1553354 |
T |
 |
| Q |
101 |
tggtgcagaagcagcagcagcaacaataagtcttttaggactaccagctgcaacaccaactttggctccaatagcagtagtagctaacaaggtttggctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1553353 |
tggtgcagaagcagcagcagcaacaataagtcttttaggactaccagctgcaacaccaactttggctccaatagcagtagtagctaacaaggtttggctt |
1553254 |
T |
 |
| Q |
201 |
ctctttcctccagataagaagg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1553253 |
ctctttcctccagataagaagg |
1553232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University