View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6059_high_20 (Length: 238)
Name: NF6059_high_20
Description: NF6059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6059_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 809766 - 809947
Alignment:
| Q |
19 |
tttgctatttgcttttactttggttatttcatcttttctattagttcagtgcacacacactttgctctttaattccaacatctttagcgagtgtagtgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
809766 |
tttgctatttgcttttactttggttatttcatcttttctattagttcagtgcacacacactttgctctttaattccaacatctttagcgagtgtagtgtt |
809865 |
T |
 |
| Q |
119 |
tggttgcatgtctatttaccgccactgctcgtccacagatttatgccatcaaatacgagaagctttactcgtagcttcaagt |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
809866 |
tggttgcatgtctattcaccgccactgctcgtccacagatttatgccatcaaatacgagaagctttactcgtagcttcaagt |
809947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 200 - 238
Target Start/End: Original strand, 809966 - 810004
Alignment:
| Q |
200 |
tatccttctgtggaaacagacatgacagtaataggtggt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
809966 |
tatccttctgtggaaacagacatgacagtaataggtggt |
810004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University