View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6059_high_7 (Length: 346)
Name: NF6059_high_7
Description: NF6059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6059_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 14 - 341
Target Start/End: Original strand, 41705415 - 41705742
Alignment:
| Q |
14 |
caactctctctcccactctcaccaggctccgattacactctctccttcaacctcggaccccactcccaacccataactctctacatggacacaggaagtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705415 |
caactctctctcccactctcaccaggctccgattacactctctccttcaacctcggaccccactcccaacccataactctctacatggacacaggaagtg |
41705514 |
T |
 |
| Q |
114 |
accttgtttggttcccatgcacaccgttcaactgcatcctctgtgaattaaaacccaagcttacctcggatccctctccccctaccaacatctcccacag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705515 |
accttgtttggttcccatgcacaccgttcaactgcatcctctgtgaattaaaacccaagcttacctcggatccctctccccctaccaacatctcccacag |
41705614 |
T |
 |
| Q |
214 |
cacccccatttcatgcaactcccatgcatgctctgtagcacacagttccaccccctcttccgatctatgcacaatggctcattgccctttagactccatt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705615 |
cacccccatttcatgcaactcccatgcatgctctgtagcacacagttccaccccctcttccgatctatgcacaatggctcattgccctttagactccatt |
41705714 |
T |
 |
| Q |
314 |
gaaaccaaagactgcggttcatctcact |
341 |
Q |
| |
|
|||||||||||||||||||||| ||||| |
|
|
| T |
41705715 |
gaaaccaaagactgcggttcatttcact |
41705742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 80 - 160
Target Start/End: Complemental strand, 3744418 - 3744338
Alignment:
| Q |
80 |
caacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgtgaa |
160 |
Q |
| |
|
|||| |||||| ||||||||||||||||| || ||||||||||||||||| || |||| ||| | ||||| ||||||||| |
|
|
| T |
3744418 |
caactcataacactctacatggacacaggtagcgaccttgtttggttcccttgttcacctttcgaatgcattctctgtgaa |
3744338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University