View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6059_low_15 (Length: 256)

Name: NF6059_low_15
Description: NF6059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6059_low_15
NF6059_low_15
[»] chr7 (2 HSPs)
chr7 (170-241)||(21831237-21831309)
chr7 (19-59)||(21831085-21831125)


Alignment Details
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 170 - 241
Target Start/End: Original strand, 21831237 - 21831309
Alignment:
170 gtgttgtgttt-ggtagagaagtggaagagaggaaattgagggaagaaggagaggtcggttacggttatggat 241  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
21831237 gtgttgtgttttggtagagaagtggaagagaggaaattgagggaagaaggagaggtcggttacagttatggat 21831309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 21831085 - 21831125
Alignment:
19 atggaaaacgctatgacaaatatgaaatgtaatggaaaacg 59  Q
    |||||||||||||||||||||||||||||||||||||||||    
21831085 atggaaaacgctatgacaaatatgaaatgtaatggaaaacg 21831125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University