View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6059_low_16 (Length: 255)
Name: NF6059_low_16
Description: NF6059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6059_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 25078171 - 25077954
Alignment:
| Q |
1 |
atagatgagtactttcactgtggtgcatcacacggcaccacacataccattcaaatactatcaagactggaatgctgcacaagcacagcttaatggaact |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25078171 |
atagatgagtactttcactgtggtacatcacacggcaccacacataccattcaaatactatcaagactggaatgctgcacaagcacagcttaatggaact |
25078072 |
T |
 |
| Q |
101 |
gttcattgtgattatcctaaatggtattatttctcttctcgttttattgcatatgatccacaaaatatatggtcct----gaataatggcaaactaacta |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
25078071 |
gttcattgtgattatcctaaatggtattatttctcttctcgttttattgcatatgatccacaatatatatggtcctgaatgaataatggcaaactaacta |
25077972 |
T |
 |
| Q |
197 |
attgctacattcctgcaa |
214 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
25077971 |
attgttacattcctgcaa |
25077954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 54617950 - 54617825
Alignment:
| Q |
1 |
atagatgagtactttcactgtggtgcatcacacggcaccacacataccattcaaatactatcaagactggaatgctgcacaagcacagcttaatggaact |
100 |
Q |
| |
|
||||||||| |||||||| |||||||||| || ||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54617950 |
atagatgagcactttcaccatggtgcatcatactgcaccacacataccattcaaaaactcagaagaatggaatgctgcacaagcacagcttaatggaacc |
54617851 |
T |
 |
| Q |
101 |
gttcattgtgattatcctaaatggta |
126 |
Q |
| |
|
|||||||||| ||| ||| ||||||| |
|
|
| T |
54617850 |
gttcattgtgcttaccctcaatggta |
54617825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University