View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6060_high_12 (Length: 238)
Name: NF6060_high_12
Description: NF6060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6060_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 1365905 - 1365692
Alignment:
| Q |
1 |
taatctatatgccactaatatattatgttgtctagtctacttgtaaacttaatcttgcgaacacaattatgtagctgatgcttgcacgtcatatatatgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1365905 |
taatctatatgccactaatatattatgttgtctagtctacttgtaaaattaatcttgcgaacacaattatgtagctgatgcttgcacgtcatatatatgt |
1365806 |
T |
|
| Q |
101 |
ggctaattcttacttaaaaacaaatatctaaatcatcatgctaataaaataatcagnnnnnnnnaggtgtgaggtactacattaatttgcttttaaacat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1365805 |
ggctaattcttacttaaaaacaaatatctaaatcatcatgc--------taatcagttttttttaggtgtgaggtactacattaatttgcttttaaacat |
1365714 |
T |
|
| Q |
201 |
gcaccaacaataaatccataat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1365713 |
gcaccaacaataaatccataat |
1365692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University