View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6060_low_9 (Length: 302)
Name: NF6060_low_9
Description: NF6060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6060_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 6e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 205 - 292
Target Start/End: Original strand, 18780258 - 18780345
Alignment:
| Q |
205 |
gttatcacagaaattgtcttaattgatttttcaaacatcactactctaatttcatttttcaaattgtttagattaaaaataccctttg |
292 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18780258 |
gttatcacaaaaattgtcttaattgatttttcaaacatcactactctaatttcatttttcaaattgtttagattaaaaataccctttg |
18780345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 18780075 - 18780157
Alignment:
| Q |
20 |
ctcgaaatagtattttcgattcctggtactttgcttgtaataattttattataaatgatatttgtataaccacattataacaa |
102 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18780075 |
ctcgaaatagtattttcgattccaagtactttgcttgtaataattttattataaatgatatttgtataaccactttataacaa |
18780157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University