View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6063_high_50 (Length: 268)
Name: NF6063_high_50
Description: NF6063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6063_high_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 177 - 255
Target Start/End: Complemental strand, 3401253 - 3401175
Alignment:
| Q |
177 |
tttcttactgattataaacaatagagaatatgcatgatctatttgccgttcacttaatttcttaatttaggtaccttgt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
3401253 |
tttcttactgattataaacaatagagaatatgcatgatctattttccattcacttaatttcttaatttaggtaccttgt |
3401175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University