View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6063_high_75 (Length: 217)
Name: NF6063_high_75
Description: NF6063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6063_high_75 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 45422322 - 45422108
Alignment:
| Q |
1 |
cttgtactctttgttgatttgatttgagaaacactgcaggtatagaaaagtttgagaagttcacttttccannnnnnngatattcacaccccatcaagta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45422322 |
cttgtactctttgttgatttgatttgagaaacactgcaggtatagaaaagtttgagaagttcacttttccatttttttgatattcacaccccatcaagta |
45422223 |
T |
|
| Q |
101 |
ctgtttctgtgagtttgttgttgcagtttggtttgaatccactcttggttttttgaaaggagttaaatatgtgaacatgtgagaggaacctaggccatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45422222 |
ctgtttctgtgagtttgttgttgcagtttggtttgaatccactcttggttttttgagaggagttaaatatgtgaacatgtgagaggaacctaggccattg |
45422123 |
T |
|
| Q |
201 |
ctttttgtcatctct |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45422122 |
ctttttgtcatctct |
45422108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University