View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6063_low_21 (Length: 410)
Name: NF6063_low_21
Description: NF6063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6063_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 394; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 1 - 398
Target Start/End: Complemental strand, 54895400 - 54895003
Alignment:
| Q |
1 |
tcaacttcatcctcttcttctctcactaacggaagaataatacctcgttcttcatcttccactacgtcgtcgtttttcaacgctcgatccaccactccga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54895400 |
tcaacttcatcctcttcttctctcactaacggaagaataatacctcgttcttcatcttccactacgtcgtcgtttttcaacgctcgatccaccactccga |
54895301 |
T |
 |
| Q |
101 |
atcgcggtcggagtgagtcaacgtgttacggaggttcgctcggtggttatagagatcgttctccggtcgcgtttggtggcgaggagctgagtgtggatcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54895300 |
atcgcggtcggagtgagtcaacgtgttacggaggttcgctcggtggttatagagatcgttctccggttgcgtttggtggcgaggagctgagtgtggatcc |
54895201 |
T |
 |
| Q |
201 |
tgttgagacgtccacgtcagcagatagcatttctgttacgattcggtttcgtccattgaggtaagggtttagatctgtgtttcgatttcagatccattgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54895200 |
tgttgagacgtccacgtcagcagatagcatttctgttacgattcggtttcgtccattgaggtaagggtttagatctgtgtttcgatttcagatccattgt |
54895101 |
T |
 |
| Q |
301 |
gtgttactgaatgattttgttgcagtgaaagggaatataataaaggggatgaaatcgcgtggtatgctgatggtgataagattgttagaaatgagtat |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54895100 |
gtgttactgaatgattttgttgcagtgaaagggaatataataaaggggatgaaatcgcgtggtatgctgatggtgataagattgttagaaatgagtat |
54895003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 319 - 396
Target Start/End: Complemental strand, 26859416 - 26859339
Alignment:
| Q |
319 |
gttgcagtgaaagggaatataataaaggggatgaaatcgcgtggtatgctgatggtgataagattgttagaaatgagt |
396 |
Q |
| |
|
||||||||||||| || ||| ||| ||| || ||||| ||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
26859416 |
gttgcagtgaaagagagtatcatagaggagacgaaattgcgtggtatgctgatggtgataagattgtgaggaatgagt |
26859339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University