View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6063_low_37 (Length: 332)
Name: NF6063_low_37
Description: NF6063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6063_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 19 - 322
Target Start/End: Original strand, 43911468 - 43911771
Alignment:
| Q |
19 |
attctgatcttttaagataagggctttacattgtatctgtgatgttaacgtcttttcatcttttaaggcaaatgtgaggcaatactacctgcaatttgaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43911468 |
attctgatcttttaagataagggctttacattgtatctgtgatgttaacgtcttttcatcttttaaggcaaatgtgaggcaatactacctgcaatttgaa |
43911567 |
T |
 |
| Q |
119 |
gagcaacaaacccaaagtttaattgatcaaaggattaaggaacatctcgggcaagctgcagcatttcagcaagttggtgtagcttttaatcccatgatgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43911568 |
gagcaacaaacccaaagtttaattgatcaaaggattaaggaacatctcgggcaagctgcagcatttcagcaagttggtgtagcttttaatcccatgatgg |
43911667 |
T |
 |
| Q |
219 |
ctcaaaggccttctatgcccatcttgccaccaccaaggttgccaattcctggaagtgttccaggctttggtggacaacaactattcccagggatgagacc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43911668 |
ctcaaaggccttctatgcccatcttgccaccaccaaggttgccaattcctggaagtgttccaggctttggtggacaacaacttttcccagggatgagacc |
43911767 |
T |
 |
| Q |
319 |
tatg |
322 |
Q |
| |
|
|||| |
|
|
| T |
43911768 |
tatg |
43911771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 109 - 208
Target Start/End: Complemental strand, 39975879 - 39975780
Alignment:
| Q |
109 |
gcaatttgaagagcaacaaacccaaagtttaattgatcaaaggattaaggaacatctcgggcaagctgcagcatttcagcaagttggtgtagcttttaat |
208 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |||| || |||||||| || |||||||| || |||||| |||||||| |||| |||| |
|
|
| T |
39975879 |
gcaatttgaagaacagcaaacccaaagtttaattgatcaacggatcaaagaacatcttggacaagctgcggcttttcaggcggttggtgtggcttataat |
39975780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University