View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6063_low_51 (Length: 268)

Name: NF6063_low_51
Description: NF6063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6063_low_51
NF6063_low_51
[»] chr1 (1 HSPs)
chr1 (177-255)||(3401175-3401253)


Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 177 - 255
Target Start/End: Complemental strand, 3401253 - 3401175
Alignment:
177 tttcttactgattataaacaatagagaatatgcatgatctatttgccgttcacttaatttcttaatttaggtaccttgt 255  Q
    |||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||    
3401253 tttcttactgattataaacaatagagaatatgcatgatctattttccattcacttaatttcttaatttaggtaccttgt 3401175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University