View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6063_low_56 (Length: 251)
Name: NF6063_low_56
Description: NF6063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6063_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 1553573 - 1553819
Alignment:
| Q |
1 |
tctttctgaattatgacttgtttaatgtttttcaattgtagactaccaggtgactttggttttgatccactaggccttggcaaggacccagcatttctga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1553573 |
tctttctgaattatgacttgtttaatgtttttcaattgtagactaccaggtgactttggttttgacccactaggccttggcaaggacccagcatttctga |
1553672 |
T |
|
| Q |
101 |
aatggtacagagaagctgagcttattcatggaaggtgggcaatggctgcagttctaggcatctttgttggtcaagcatggagtggagttccatggtttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1553673 |
aatggtacagagaagctgagcttattcatggaaggtgggcaatggctgcagttctaggcatctttgttggtcaagcatggagtggagttccatggtttga |
1553772 |
T |
|
| Q |
201 |
ggctggagctgaccccaatgcaattgctccattctcctttgctactc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1553773 |
ggctggagctgaccccaatgcaattgctccattctcctttggtactc |
1553819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University