View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6063_low_58 (Length: 251)
Name: NF6063_low_58
Description: NF6063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6063_low_58 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 29269212 - 29269452
Alignment:
| Q |
11 |
caaaggaagggtgttcacaagggaagactcttgatcatatagtttaaaggctaacatgaagcgatgnnnnnnntcagaaaataaaattagcgatttgcat |
110 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
29269212 |
caaaagaagggtgttcacaaaggaagactcttgatcatatagcttaaaggctaacatgaagcgatgaaaaaaatcagaaaataaaattagcaatttgcat |
29269311 |
T |
 |
| Q |
111 |
ctatgaacttagttcatattttagaaaccaaattgacagaattcatttcggattatttaagttgaactaaaaatccaaagtnnnnnnnntcaaacactaa |
210 |
Q |
| |
|
|| |||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29269312 |
ctgtgaactcagttcatattttagaaaccaaattgacagaattcatttcgaattatggaagttgaactaaaaatccaaagtaaaaaaaatcaaacactaa |
29269411 |
T |
 |
| Q |
211 |
tgagttgagcaaatgtgtactaaccttttctggatgagcac |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||| || |||||||| |
|
|
| T |
29269412 |
tgagttgagcaaatgtgtaccaaccttttgtgaatgagcac |
29269452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University