View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6063_low_64 (Length: 245)
Name: NF6063_low_64
Description: NF6063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6063_low_64 |
 |  |
|
| [»] scaffold0299 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 15 - 230
Target Start/End: Original strand, 40024013 - 40024228
Alignment:
| Q |
15 |
gggaatgaagaaaaactgtttggtcgggatacggaagcgatccgggacaaagcaaggaaattattttttaaaaaggaaagacaagaaaaagggttcttag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40024013 |
gggaatgaagaaaaactgtttggtcgggatacggaagcgatccgggacaaagcaaggaaattattttttaaaaaggaaagacaagaaaaagggttcttag |
40024112 |
T |
 |
| Q |
115 |
cgtcacggcgtaaaagaaaaggtaaggctatgaaggaaattatctaattgtttataagttttagctgttcaagataccattgtttgatacaggataccgg |
214 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40024113 |
agtctcggcgtaaaagaaaaggtaaggctatgaaggaaattatctaattgtttataagttttagctgtgcaagataccattgtttgatacaggataccgg |
40024212 |
T |
 |
| Q |
215 |
tgaattttggtgttac |
230 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40024213 |
tgaattttggtgttac |
40024228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 176 - 230
Target Start/End: Original strand, 40024520 - 40024574
Alignment:
| Q |
176 |
tagctgttcaagataccattgtttgatacaggataccggtgaattttggtgttac |
230 |
Q |
| |
|
||||||| ||| |||| ||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
40024520 |
tagctgtgcaaaatactattgtttgatacatgatactggtgaattttggtgttac |
40024574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 230
Target Start/End: Original strand, 40138035 - 40138089
Alignment:
| Q |
176 |
tagctgttcaagataccattgtttgatacaggataccggtgaattttggtgttac |
230 |
Q |
| |
|
||||||| ||| |||| ||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
40138035 |
tagctgtgcaaaatactattgtttgatacatgatactagtgaattttggtgttac |
40138089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 6756850 - 6756772
Alignment:
| Q |
19 |
atgaagaaaaactgtttggtcgggatacggaagcgatccgggacaaagcaaggaaattattttttaaaaaggaaagacaaga |
100 |
Q |
| |
|
||||||||||| |||||||||||||| | ||| ||| |||||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
6756850 |
atgaagaaaaattgtttggtcgggatttgaaagtgattcgggacaaggcaaggaa---actttttaaaaaggaaagacaaga |
6756772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 6756482 - 6756425
Alignment:
| Q |
19 |
atgaagaaaaactgtttggtcgggatacggaagcgatccgggacaaagcaaggaaatt |
76 |
Q |
| |
|
|||||||||||||||||||||||||| | | ||||| | |||||| ||||||||||| |
|
|
| T |
6756482 |
atgaagaaaaactgtttggtcgggatttgaatgcgattcaggacaaggcaaggaaatt |
6756425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 74
Target Start/End: Complemental strand, 6765416 - 6765363
Alignment:
| Q |
21 |
gaagaaaaactgtttggtcgggatacggaagcgatccgggacaaagcaaggaaa |
74 |
Q |
| |
|
||||||||| |||||||||||||| | ||||||| |||||||| ||||||||| |
|
|
| T |
6765416 |
gaagaaaaattgtttggtcgggatttgaaagcgattcgggacaaggcaaggaaa |
6765363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0299 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0299
Description:
Target: scaffold0299; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 74
Target Start/End: Original strand, 14542 - 14597
Alignment:
| Q |
19 |
atgaagaaaaactgtttggtcgggatacggaagcgatccgggacaaagcaaggaaa |
74 |
Q |
| |
|
||||||||||| |||||||||||||| | ||||||| |||||||| ||||||||| |
|
|
| T |
14542 |
atgaagaaaaattgtttggtcgggatttgaaagcgattcgggacaaggcaaggaaa |
14597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University