View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6063_low_73 (Length: 233)
Name: NF6063_low_73
Description: NF6063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6063_low_73 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 3121307 - 3121075
Alignment:
| Q |
1 |
tggtaacaaaatgaaccaaaccagtgatccatatgtcacagtttctgtggctggtgctgtgattgcaagaacttctgtgatcagaaatgatgagaaccct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3121307 |
tggtaacaaaatgaaccaaaccagtgatccatatgtcacagtttctgtggctggtgctgtgattgctagaacttctgtgatcagaaatgatgagaaccct |
3121208 |
T |
 |
| Q |
101 |
gtttggatgcaacattttaatgtacctgttgcacaccaagcatcagagattcactttgttgtaaaagacagtgatattgttggttcacagcttattggtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3121207 |
gtttggatgcaacattttaatgtacctgttgcacatcaagcatcagagattcactttgttgtaaaagacagtgatattgttggttcacagcttattggtg |
3121108 |
T |
 |
| Q |
201 |
cagttggaattccagttgaaaagttatgtgatg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3121107 |
cagttggaattccagttgaaaagttatgtgatg |
3121075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 19 - 233
Target Start/End: Complemental strand, 3115433 - 3115219
Alignment:
| Q |
19 |
aaccagtgatccatatgtcacagtttctgtggctggtgctgtgattgcaagaacttctgtgatcagaaatgatgagaaccctgtttggatgcaacatttt |
118 |
Q |
| |
|
|||||||||||||||||| || |||||||| ||||||||||| ||||||||||||| ||| || ||||| |||||||||||||||||| || || || |
|
|
| T |
3115433 |
aaccagtgatccatatgtaactgtttctgtagctggtgctgttattgcaagaacttttgtaattagaaacaatgagaaccctgtttggaatcagcacttc |
3115334 |
T |
 |
| Q |
119 |
aatgtacctgttgcacaccaagcatcagagattcactttgttgtaaaagacagtgatattgttggttcacagcttattggtgcagttggaattccagttg |
218 |
Q |
| |
|
||||||||||||||||| | |||||||| |||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
3115333 |
aatgtacctgttgcacatcttgcatcagaaattcactttgttgtaaaagacaatgatattgttggttcacaggttattggtgcagttggaattccagtag |
3115234 |
T |
 |
| Q |
219 |
aaaagttatgtgatg |
233 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
3115233 |
aaaaattatgtgatg |
3115219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University