View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6063_low_77 (Length: 219)
Name: NF6063_low_77
Description: NF6063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6063_low_77 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 55711401 - 55711535
Alignment:
| Q |
1 |
gccgctgttgcatttggtagcttcagaatttggagccgtgctcacattcacattcctgtcccctttcctccctccgcaggagactttaccatacttgctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55711401 |
gccgctgttgcatttggtagcttcagaatttggagccgtgctcacattcagattcctgtcccctttcctccctccgcaggagactttaccatacttgctg |
55711500 |
T |
|
| Q |
101 |
gtgattggttcaagctaggccaccgcgtaattaaa |
135 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
55711501 |
gtgattggttcaagctaggccaccgtgtaattaaa |
55711535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 4 - 131
Target Start/End: Original strand, 55295482 - 55295603
Alignment:
| Q |
4 |
gctgttgcatttggtagcttcagaatttggagccgtgctcacattcacattcctgtcccctttcctccctccgcaggagactttaccatacttgctggtg |
103 |
Q |
| |
|
|||| |||||||||| || ||||||||||||||||| ||| ||||| |||| || |||||||| | || || ||||||||| |||||||||||| |
|
|
| T |
55295482 |
gctggtgcatttggtggcatcagaatttggagccgtcctcgcattc------ctgttccttttcctcctcctgctggggactttaccttacttgctggtg |
55295575 |
T |
|
| Q |
104 |
attggttcaagctaggccaccgcgtaat |
131 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
55295576 |
attggtccaagctaggccaccgcgtaat |
55295603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University