View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6063_low_82 (Length: 212)
Name: NF6063_low_82
Description: NF6063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6063_low_82 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 27443786 - 27443992
Alignment:
| Q |
1 |
aaactattttcaatgacacctatgtttagccaattaaaattttagtgaagtttttaaaacatacagcctgtttttctaattcnnnnnnnnnctttctcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
27443786 |
aaactattttcaatgacacctatgtttagccaattaaaattttagtgaagtttttaaaacttacagcctgtttttctaattctttttttttctttctcaa |
27443885 |
T |
 |
| Q |
101 |
tggtcaaactttagacttggtcatagaagtggctaataccacatcttaaaccaactctttatattatatcaaaatgtcaaacttcataaagtcgtaccta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27443886 |
tggtcaaactttagacttggtcatagaagtggctaataccacatcttgaaccaactctttatattatatcaaaatgtcaaacttcataaagtcgtaccta |
27443985 |
T |
 |
| Q |
201 |
tgctact |
207 |
Q |
| |
|
| ||||| |
|
|
| T |
27443986 |
tactact |
27443992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 97 - 145
Target Start/End: Original strand, 27441068 - 27441115
Alignment:
| Q |
97 |
tcaatggtcaaactttagacttggtcatagaagtggctaataccacatc |
145 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||| ||||||| |
|
|
| T |
27441068 |
tcaatggtcaaactttagacttagtcatagaagt-gctaatgccacatc |
27441115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 65
Target Start/End: Original strand, 27429518 - 27429564
Alignment:
| Q |
19 |
cctatgtttagccaattaaaattttagtgaagtttttaaaacataca |
65 |
Q |
| |
|
|||||||||||||||||||||||||| | | |||||||||| ||||| |
|
|
| T |
27429518 |
cctatgtttagccaattaaaattttaataaggtttttaaaatataca |
27429564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University