View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6063_low_83 (Length: 212)
Name: NF6063_low_83
Description: NF6063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6063_low_83 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 196
Target Start/End: Original strand, 20415130 - 20415312
Alignment:
| Q |
15 |
caaaggtgattaatgatgtgcatcaacaatgctgtgcattgtactttaatgatagtgaaacggtaagtcatt-gtttctgagttataaaaactaaggaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20415130 |
caaaggtgattaatgatgtgcatcaacaatgttgtgcattgtactttaatgatagtgaaacggtaagtcatttgtttctgagttataaaaactaaggaaa |
20415229 |
T |
|
| Q |
114 |
tttgaagttggttttggaatggttggattggagtgctttggggtgggaagggaaaatggtggtaaatttcttgttgtgtaact |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20415230 |
attgaagttggttttggaatggttggattggagcgctttggggtgggaagggaaaatggtggtaaatttcttgttgtgtaact |
20415312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University