View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6066_low_5 (Length: 221)
Name: NF6066_low_5
Description: NF6066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6066_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 16469920 - 16470117
Alignment:
| Q |
18 |
gaaacatgttcatatgatacaatctgaccttttgtactttgttgcaatgatggttctataggtgtgatgattttaacatcttgatctgcactaggaacga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
16469920 |
gaaacatgttcatatgatacaatctgaccttttgtactttgttgcaatgatggttctataggtgtgatgattgtaacatcttgatctgcactagggacga |
16470019 |
T |
|
| Q |
118 |
catgttctgcatgagatataactggtattacattagtaatatgaggcacttcaaatgctttcgagggcccaatcccatttggttatattcttcgacat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
16470020 |
catgttctgcatgagatataactggtattatattagtaatatgaggtacttcaaatgctttcgagggcccaatcccatttggttatgtttttcgacat |
16470117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 66
Target Start/End: Original strand, 6071606 - 6071648
Alignment:
| Q |
24 |
tgttcatatgatacaatctgaccttttgtactttgttgcaatg |
66 |
Q |
| |
|
||||||||||||||| | ||||||||||||| ||||||||||| |
|
|
| T |
6071606 |
tgttcatatgatacagtgtgaccttttgtaccttgttgcaatg |
6071648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 20 - 77
Target Start/End: Complemental strand, 27521189 - 27521132
Alignment:
| Q |
20 |
aacatgttcatatgatacaatctgaccttttgtactttgttgcaatgatggttctata |
77 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
27521189 |
aacaagttcatatgatatggtctgaccttttgtaccttattgcaatgatggttatata |
27521132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University