View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6067_low_2 (Length: 400)
Name: NF6067_low_2
Description: NF6067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6067_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 151 - 386
Target Start/End: Original strand, 43291380 - 43291614
Alignment:
| Q |
151 |
gatgaacatatcttttatgaaactcaggtataattgagtaagatgcggtttcttgttatcctaaaatgtcattttatgtatagataaagttattttaaaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43291380 |
gatgaacatatcttttatgaaactcaggtataattgagtaagatgcggtttcttgttatcctaaaatgtcattttatgtatagataaagttattttaaaa |
43291479 |
T |
 |
| Q |
251 |
ggtccctttcaacgaattattatttttgaaagataccgatgacttcatgaatcatcttataatctattaatataattaaaaatagttctcnnnnnnnata |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43291480 |
ggtccctttcaacgaattattatttttgaaagataccgatgacttcatgaatcatcttataatctattaatataattaaaaatagttctc-ttttttata |
43291578 |
T |
 |
| Q |
351 |
catagaaaaaatatctttcctacgagaactgttttt |
386 |
Q |
| |
|
||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
43291579 |
catggaaaaaatatctttcctactagaactgttttt |
43291614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University