View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6068_low_3 (Length: 364)
Name: NF6068_low_3
Description: NF6068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6068_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 2 - 188
Target Start/End: Complemental strand, 35878254 - 35878068
Alignment:
| Q |
2 |
ttttttatttcaattttcatcagtttataaaagaatagagataattaataaatctaattgaaattgtgtcaatcagatcaagcccttgttaacatagcca |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35878254 |
ttttttatttcaattttcatcagtttataaaagaatagagataattaataaatctaattgaaattgtttcaatcagatcaagcccttgttaacatagcca |
35878155 |
T |
|
| Q |
102 |
ttgatattaaagttagattaattatttacaatgataatatgaaattaaagatcttgttcccctgaatcgatgttcacgacacagtat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35878154 |
ttgatattaaagttagattaattatttacaatgataatatgaaattaaagatcttgttcccctgaatcgatgttcacgacacagtat |
35878068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University