View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6069_low_2 (Length: 433)
Name: NF6069_low_2
Description: NF6069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6069_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 10 - 351
Target Start/End: Original strand, 33225864 - 33226189
Alignment:
| Q |
10 |
attatactaaaatggaaagaacgaggttgaaagcaacatccatatgacatactaactgcactgaatccatcccttttctttaaatgaaattttatttttt |
109 |
Q |
| |
|
|||||||||||||||||||||| || |||||| ||||||||||||| ||||||||||||||||||||| ||||||||| ||||| ||||||| |
|
|
| T |
33225864 |
attatactaaaatggaaagaacaagtttgaaaacaacatccatatg---------ctgcactgaatccatcccttt-ctttaaatggaatttgatttttt |
33225953 |
T |
 |
| Q |
110 |
gtcaaccccc-acaaaagaatgatgcaaaatgaagtacttatgttaagctctccttttgcagtttatgggagcatatgtggaaccattaatgttgataat |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |||| |||||| |||||||||||| |
|
|
| T |
33225954 |
gtcaaccccccacaaaagaatgatgcaaaatgaagtacttatgttaagctca--ttttgcagtttattggagcatctgtgaaaccatcaatgttgataat |
33226051 |
T |
 |
| Q |
209 |
cacggaacttttggaagctggtttcactttattagaaacacttaagagagtatttatctaagttttactttagatatttctcaagcaatggaatatttac |
308 |
Q |
| |
|
||||||||||||||||||| ||| ||||||| |||||||||| |||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
33226052 |
cacggaacttttggaagctagtt-cacttta---gaaacactta-gagagtatttatctaagttttacttttgatatttcttaagcaatggaatatttac |
33226146 |
T |
 |
| Q |
309 |
atgcaaatggcatcattcaccgtgatctaaagccatgcaatga |
351 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
33226147 |
atgcaaatgacataattcaccgtgatctaaagccatgcaatga |
33226189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 267 - 339
Target Start/End: Complemental strand, 33227183 - 33227111
Alignment:
| Q |
267 |
taagttttactttagatatttctcaagcaatggaatatttacatgcaaatggcatcattcaccgtgatctaaa |
339 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
33227183 |
taagttttacttttgatatttcttaagcaatggaatatttacatgcaaatgacatcattcatcgtgatctaaa |
33227111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 79; Significance: 9e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 10 - 88
Target Start/End: Complemental strand, 10528822 - 10528744
Alignment:
| Q |
10 |
attatactaaaatggaaagaacgaggttgaaagcaacatccatatgacatactaactgcactgaatccatcccttttct |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10528822 |
attatactaaaatggaaagaacgaggttgaaagcaacatccatatgacatactaactgcactgaatccatcccttttct |
10528744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 267 - 343
Target Start/End: Original strand, 10528090 - 10528166
Alignment:
| Q |
267 |
taagttttactttagatatttctcaagcaatggaatatttacatgcaaatggcatcattcaccgtgatctaaagcca |
343 |
Q |
| |
|
|||||||| |||| |||||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10528090 |
taagttttgcttttgatatttctcaagctatggagtatttacatgcaaatgacatcattcaccgtgatctaaagcca |
10528166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 281 - 342
Target Start/End: Original strand, 7469712 - 7469773
Alignment:
| Q |
281 |
gatatttctcaagcaatggaatatttacatgcaaatggcatcattcaccgtgatctaaagcc |
342 |
Q |
| |
|
|||||||| ||||||||||||||| | ||||||||||| || |||||||||||||| ||||| |
|
|
| T |
7469712 |
gatatttcacaagcaatggaatatctgcatgcaaatggaataattcaccgtgatctcaagcc |
7469773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University