View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6069_low_6 (Length: 230)
Name: NF6069_low_6
Description: NF6069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6069_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 55 - 215
Target Start/End: Complemental strand, 31682061 - 31681903
Alignment:
| Q |
55 |
tggttagggcaggacctaaagggtttggtcaaaagattgttcaaacggaagatgatgattgattaggtcctccaatgcatttttgcattgaaatcagatt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31682061 |
tggttagggcaggacctaaagggtttggtcaaaagattgttcaaacggaagatgatgattgattaggtcctccaatgcatttttgcattgaaatcagatt |
31681962 |
T |
 |
| Q |
155 |
tattttacttgaaccnnnnnnnccccgatggtttagaaagttgtgtagtcatcacaatgtt |
215 |
Q |
| |
|
|| ||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31681961 |
ta--ttacttgaacctttttttccccgatggttaagaaagttgtgtagtcatcacaatgtt |
31681903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 55 - 215
Target Start/End: Complemental strand, 41725034 - 41724873
Alignment:
| Q |
55 |
tggttagggcaggacctaaagggtttggtcaaaagattgttcaaacggaagatgatgattgattaggtcctccaatgcatttttgcattgaaatcagatt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41725034 |
tggttagggcaggacctaaagggtttggtcaaaagattgttcaaacggaagatgatgattgattaggtcctccgatgcatttttgcattgaaatcagatc |
41724935 |
T |
 |
| Q |
155 |
tattttacttgaacc-nnnnnnnccccgatggtttagaaagttgtgtagtcatcacaatgtt |
215 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41724934 |
tattttacttgaacctttttttcccccgattgtttagaaagttgtgtagtcatcacaatgtt |
41724873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University