View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6070_high_2 (Length: 208)
Name: NF6070_high_2
Description: NF6070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6070_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 8e-94; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 16 - 189
Target Start/End: Complemental strand, 42640278 - 42640105
Alignment:
| Q |
16 |
aatatgactatgatgggaaacaaatcactaagcatatgtatggcaacacttgccatagccttttttattatgatcatggttccaaaaaatgttagtgctc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42640278 |
aatatgactatgatgggaaacaaatcactaagcatatgtatggcaacacttgccatagccttttttattatgatcatggttccaaaaaatgttagtgctc |
42640179 |
T |
 |
| Q |
116 |
aaaattgtgggtgtgctgaaggagtgtgttgcagccaatacgggtattgtggtaatggtgatgcatattgtggc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42640178 |
aaaattgtgggtgtgctgaaggagtgtgttgcagccaatacgggtattgtggtaatggtgatgcatattgtggc |
42640105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 16 - 189
Target Start/End: Complemental strand, 42629124 - 42628951
Alignment:
| Q |
16 |
aatatgactatgatgggaaacaaatcactaagcatatgtatggcaacacttgccatagccttttttattatgatcatggttccaaaaaatgttagtgctc |
115 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| | ||| |||| |||||| |||||||||||||||||||| ||||||||||||| | ||||||||| |
|
|
| T |
42629124 |
aatatgactatgataggaaacaaatcactaagcatgtctatagcaaaacttgctatagccttttttattatgattatggttccaaaaagtattagtgctc |
42629025 |
T |
 |
| Q |
116 |
aaaattgtgggtgtgctgaaggagtgtgttgcagccaatacgggtattgtggtaatggtgatgcatattgtggc |
189 |
Q |
| |
|
||||||||||||||| ||||| | ||||| ||||||| ||||| |||||||| |||| ||||||||||| |
|
|
| T |
42629024 |
aaaattgtgggtgtgaggaaggtttatgttgtagccaatttgggtactgtggtaacactgatccatattgtggc |
42628951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University