View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6070_low_1 (Length: 249)
Name: NF6070_low_1
Description: NF6070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6070_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 30 - 230
Target Start/End: Original strand, 8016578 - 8016778
Alignment:
| Q |
30 |
aataataaaaataacaaacaaggaagagtggatcatcagagataacatatttattagtgtatgacatacgacatacatacccggagggaagagtgtggac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016578 |
aataataaaaataacaaacaaggaagagtggatcatcagagataacatatttattagtgtatgacatacgacatacatacccggagggaagagtgtggac |
8016677 |
T |
 |
| Q |
130 |
ataagttggtatcatgggaagcccgggcccatcaacggaggaaagcccagcccgcatttcagaagacattgcatcagcaacatggtgaagaagaggtaga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016678 |
ataagttggtatcatgggaagcccgggcccatcaacggaggaaagcccagcccgcatttcagaagacattgcatcagcaacatggtgaagaagaggtaga |
8016777 |
T |
 |
| Q |
230 |
g |
230 |
Q |
| |
|
| |
|
|
| T |
8016778 |
g |
8016778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University