View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6070_low_2 (Length: 240)
Name: NF6070_low_2
Description: NF6070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6070_low_2 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 24541770 - 24541547
Alignment:
| Q |
17 |
attgtttgatataatgcctgaaagaagatttacactgaatgtgttacagattttctgttatgattatcatgattatgagagtcttatactctaatctaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24541770 |
attgtttgatataatgcctgaaagaagatttacactgaatgtgttacagattttctgttatgattatcatgattatgagagtcttatactcttatctaat |
24541671 |
T |
 |
| Q |
117 |
tggttatgtgtgtgagcgccgggggcgnnnnnnnccttcgtttcttaaactttatattttaatgtttgcttcgattaatgtcgatatgcatctatatctt |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24541670 |
tggttatgtgtgtgagcgccgggggcgtttttttccttcgtttcttaaactttatattttaatgtttgcttcgattaatgtcgatatgcatctatatctt |
24541571 |
T |
 |
| Q |
217 |
tacttctcagatactgtgatattc |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24541570 |
tacttctcagatactgtgatattc |
24541547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University