View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6070_low_3 (Length: 208)

Name: NF6070_low_3
Description: NF6070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6070_low_3
NF6070_low_3
[»] chr2 (2 HSPs)
chr2 (16-189)||(42640105-42640278)
chr2 (16-189)||(42628951-42629124)


Alignment Details
Target: chr2 (Bit Score: 174; Significance: 8e-94; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 16 - 189
Target Start/End: Complemental strand, 42640278 - 42640105
Alignment:
16 aatatgactatgatgggaaacaaatcactaagcatatgtatggcaacacttgccatagccttttttattatgatcatggttccaaaaaatgttagtgctc 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42640278 aatatgactatgatgggaaacaaatcactaagcatatgtatggcaacacttgccatagccttttttattatgatcatggttccaaaaaatgttagtgctc 42640179  T
116 aaaattgtgggtgtgctgaaggagtgtgttgcagccaatacgggtattgtggtaatggtgatgcatattgtggc 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42640178 aaaattgtgggtgtgctgaaggagtgtgttgcagccaatacgggtattgtggtaatggtgatgcatattgtggc 42640105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 16 - 189
Target Start/End: Complemental strand, 42629124 - 42628951
Alignment:
16 aatatgactatgatgggaaacaaatcactaagcatatgtatggcaacacttgccatagccttttttattatgatcatggttccaaaaaatgttagtgctc 115  Q
    |||||||||||||| |||||||||||||||||||| | ||| |||| |||||| |||||||||||||||||||| ||||||||||||| | |||||||||    
42629124 aatatgactatgataggaaacaaatcactaagcatgtctatagcaaaacttgctatagccttttttattatgattatggttccaaaaagtattagtgctc 42629025  T
116 aaaattgtgggtgtgctgaaggagtgtgttgcagccaatacgggtattgtggtaatggtgatgcatattgtggc 189  Q
    |||||||||||||||  |||||  | ||||| |||||||  ||||| ||||||||   |||| |||||||||||    
42629024 aaaattgtgggtgtgaggaaggtttatgttgtagccaatttgggtactgtggtaacactgatccatattgtggc 42628951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University