View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6072_high_1 (Length: 461)
Name: NF6072_high_1
Description: NF6072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6072_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 390; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 390; E-Value: 0
Query Start/End: Original strand, 5 - 398
Target Start/End: Complemental strand, 51591336 - 51590943
Alignment:
| Q |
5 |
gaggaagtaatcgccaaggttagagggaacacgaaacccaggttcggattcagaaggattattgatctcgaattgaatgtttgcaccgtcggcgtgaagg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51591336 |
gaggaagtaatcgccaaggttagagggaacacgaaacccaggttcggattcagaaggattattgatctcgaattgaatgtttgcaccgtcggcgtgaagg |
51591237 |
T |
|
| Q |
105 |
ccgttgagatgattctgaaggaaagcgaatgggtcgaaactgtcggaatcgggtcgggtccgggaaacggaagcagaattaaggagtaatgggagaagag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51591236 |
ccgttgagatgattctgaaggaaagcgaatgggtcgaaactgtcggaatcgggtcgggtccgggaaacggaagcagaattaaggagtaatgggagaagag |
51591137 |
T |
|
| Q |
205 |
cgaagggatggaatgggaattcggaatctgaatcggaggaatgatcgtgatgatggttgaagcggaaaatcacgttagggttagggttaggttcgggttg |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51591136 |
cgaagggatggaatgggaattcggaatctgaatcggaggaatgatcttgatgatggttgaagcggaaaatcacgttagggttagggttaggttcgggttg |
51591037 |
T |
|
| Q |
305 |
ttcacattcttcgagaaaaccttggaagcaaattgggcagaaaggttcggaatcatcgtcggtgcaggtaactctccgactgcatacgtggcag |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51591036 |
ttcacattcttcgagaaaaccttggaagcaaattgggcagaaaggttcggaatcatcgtcggtgcaggtaactctccgactgcatacgtggcag |
51590943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University