View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6072_low_13 (Length: 230)

Name: NF6072_low_13
Description: NF6072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6072_low_13
NF6072_low_13
[»] chr4 (1 HSPs)
chr4 (18-214)||(53453592-53453788)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 53453592 - 53453788
Alignment:
18 atcaatgatttcgcaaaactcaacgacatcaaaatcgtgtgcattgattcatcaccggaggaagatgaacatgttgtgaacttttctgctttaacaaatg 117  Q
    ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||||| |||||||||||    
53453592 atcaacgatttcgcaaaactcatcgacatcaaaatcgtgtgcattgattcatcaccggaggaagatgaaaatgttgtggatttttctgttttaacaaatg 53453691  T
118 ctgatgaaaacgaattaccagaagttaaaataaacccaaacgacgtggttgcgttaccgttttcttcaggaacttctggtttaccaaaaggtgttat 214  Q
    ||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||    
53453692 ctgatgaaaacgaattaccagaagtaaaaataaacccaaacgatgtagttgcgttaccgttttcttcaggaacttctggtttaccaaaaggtgttat 53453788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University