View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6072_low_13 (Length: 230)
Name: NF6072_low_13
Description: NF6072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6072_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 53453592 - 53453788
Alignment:
| Q |
18 |
atcaatgatttcgcaaaactcaacgacatcaaaatcgtgtgcattgattcatcaccggaggaagatgaacatgttgtgaacttttctgctttaacaaatg |
117 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||||| ||||||||||| |
|
|
| T |
53453592 |
atcaacgatttcgcaaaactcatcgacatcaaaatcgtgtgcattgattcatcaccggaggaagatgaaaatgttgtggatttttctgttttaacaaatg |
53453691 |
T |
 |
| Q |
118 |
ctgatgaaaacgaattaccagaagttaaaataaacccaaacgacgtggttgcgttaccgttttcttcaggaacttctggtttaccaaaaggtgttat |
214 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53453692 |
ctgatgaaaacgaattaccagaagtaaaaataaacccaaacgatgtagttgcgttaccgttttcttcaggaacttctggtttaccaaaaggtgttat |
53453788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University