View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6072_low_4 (Length: 415)
Name: NF6072_low_4
Description: NF6072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6072_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 35476891 - 35476637
Alignment:
| Q |
1 |
ggtgggggaagtggtgaggaacagataacgaaaatgaggtttgaaaggaaaccacaccacatgaacgatggggatggacatggacacggtggtggggtaa |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35476891 |
ggtgggggaagtggtgagggacagataacgaaaatgaggtttgaaaggaaaccacaccacatgaacgatggggatggacatggacacggtggtggggtaa |
35476792 |
T |
 |
| Q |
101 |
ttctataagcatggacctatatctatatatggtccactaccctagctaaataatactataaaacaaatgtgatgtattagtttgaccaaaaaatatgcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35476791 |
ttctataagcatggacctatatctatatatggtccactaccctagctaaataatactacaaaacaaatgtgatgtattagtttgaccaaaaaatatgcac |
35476692 |
T |
 |
| Q |
201 |
caacaatatacnnnnnnncttttagaaatgctaacttgtatccttaaggcacaag |
255 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35476691 |
caacaatatactttatttcttttagaaatgctaacttgtgtccttaaggcacaag |
35476637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 294 - 366
Target Start/End: Complemental strand, 35476598 - 35476526
Alignment:
| Q |
294 |
ttgagatgtttataaatgaaattcttaaattcttaaatttaccttgagttgtgccaatgctagaggatgttcg |
366 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35476598 |
ttgagatgtttataaatgctatccttaaattcttaaatttaccttgagttgtgccaatgctagaggatgttcg |
35476526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University