View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6072_low_9 (Length: 263)
Name: NF6072_low_9
Description: NF6072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6072_low_9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 8 - 263
Target Start/End: Original strand, 18020357 - 18020612
Alignment:
| Q |
8 |
catcatcaaccagttcaaatgagacagattgcctaatgctgcaggaatatttccagacaactgattgtctgagagttttagaatctccaagtgctgaagt |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18020357 |
catcagcaaccagttcaaatgagacagattgcctaatgctgcaggaatatttccagacaactgattgtctgagagttttagaatctccaagtgctgaagt |
18020456 |
T |
 |
| Q |
108 |
gttccaagttcatttggcaaagaaccggtaaaacgattcctgctgagatctaggcgctgcaatctctggcaccaaacaatttcagtggggattcttccgg |
207 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18020457 |
gttccgagttcatttggcaaagaaccggtaaaacgattcctgctgagatctaggcgctgcaatctctggcaccaaacaatttcagtggggattcttccgg |
18020556 |
T |
 |
| Q |
208 |
tgaaaaggtttgatgaaacattaaaagttaccacttgagatagatttcctatttcc |
263 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
18020557 |
tgaaaaggtttgacgaaacattaaaagttaccaattgagatagatttcccatttcc |
18020612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University