View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6074_high_15 (Length: 357)
Name: NF6074_high_15
Description: NF6074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6074_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 9 - 339
Target Start/End: Original strand, 45397990 - 45398317
Alignment:
| Q |
9 |
attatacttggaattggaattggaattggaatattggatgaatagaagtaatta-ttaatacatatatacctcgggtgagttagctagagtcctggcaag |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| || |||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45397990 |
attatatttggaattggaattggaattggaatattggatggattgaagtaattaattaatacata----cctcgggtgagttagctagagtcctggcaag |
45398085 |
T |
 |
| Q |
108 |
tgcaactctttgagcttgacccacagagaggtcagcacctgacttatccttaaaagtagaagcatctagatccgccattaacagcaacttccccacctca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45398086 |
tgcaactctttgagcttgacccacagagagttcagcacctgacttatccttaaaagtagaagcatctagatccgccattaacagcaacttccccacctca |
45398185 |
T |
 |
| Q |
208 |
tcgtccgttagctttattcccctcagttgtggaccatatctcacgttgtccgcaactgtaccttcaaagagagcagggagctgaaagagcatggcgacct |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45398186 |
tcgtccgttagctttattcccctcagttgtggtccatatctcacgttgtccgcaactgtaccttcaaagagagcagggagctgaaagagcatggcgacct |
45398285 |
T |
 |
| Q |
308 |
tacggcggagggaaagaacgtcaaggttacat |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45398286 |
tacggcggagggaaagaacgtcaaggttacat |
45398317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University