View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6074_high_21 (Length: 322)
Name: NF6074_high_21
Description: NF6074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6074_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 20 - 315
Target Start/End: Complemental strand, 29969607 - 29969312
Alignment:
| Q |
20 |
cagacttcatttcctttaaatgctacttgggctcgaattgagatttggaactcttggcacccagctgaggggagtgcttctgtgttgaatgttgacggta |
119 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29969607 |
cagacttcatttcctttaaatgctactcgggctcgaattgagatttggaactcttggcacccagctgaggggagtgcttctgtgttgaatgttgacggta |
29969508 |
T |
 |
| Q |
120 |
gcagtttggggaatcctggtgcgtctggctttgggggagtccttagaaactccgacggctcctggattggaagtttttcgggtagtgttggcttttcaaa |
219 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29969507 |
gcagtttggggaatcctggtgcatctggctttgggggagtccttagaaacttcgacggctcctggattggaagtttttcgggtagtgttggcttttcaaa |
29969408 |
T |
 |
| Q |
220 |
tgtccttcatgttgagcttctagatttatatgatgggtttaggattggttgcaacaaagttcttagaacgctggtttgttacaccgactcaacctt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29969407 |
tgtccttcatgttgagcttctagatttatatgatgggtttaggattggttgcaacaaagttcttagaacgctggtttgttacaccgactcaacctt |
29969312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 258
Target Start/End: Original strand, 45915884 - 45915940
Alignment:
| Q |
202 |
tagtgttggcttttcaaatgtccttcatgttgagcttctagatttatatgatgggtt |
258 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
45915884 |
tagtgttggcttttcgaatgtccttcatgttgagcttctagctttatatcatgggtt |
45915940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University