View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6074_high_35 (Length: 241)
Name: NF6074_high_35
Description: NF6074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6074_high_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 40082593 - 40082381
Alignment:
| Q |
1 |
ctttcatttttagtttcaaaaccatacatagnnnnnnnnnnnnttacaacaaagttcattttttgaatttaataaaacaaagttcattttatatgttgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40082593 |
ctttcatttttagtttcaaaaccatacatagaaaaaacaaaaattacaacaaagttcattttttgaatttaataaaacaaagttcattttatatgttgga |
40082494 |
T |
 |
| Q |
101 |
accccaataaattaacatgtcatgaaaaaatcatcatcccttttttcttttctttgcagtcctcaaataatattatgtggtcactccactagttatgtag |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40082493 |
actccaataaattaacatgtcatgaaaaaatcatcatcccttttttcttttctttgcagtcctcaaataatattatgtcgtcactccactagttatgtag |
40082394 |
T |
 |
| Q |
201 |
gatattactattc |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40082393 |
gatattactattc |
40082381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University