View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6074_high_38 (Length: 238)
Name: NF6074_high_38
Description: NF6074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6074_high_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 40082862 - 40083086
Alignment:
| Q |
1 |
tgaggagtaaaagattagtattgcattttcattgttcaaagacaaagaggtaaaaagaagaaggaacaaaagttacactgtatatatacaacacaaacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40082862 |
tgaggagtaaaagattagtattgcattttcattgttcaaagacaaagaggtaaaaagaagaaggaacaaaagttaccctgtatatatacaacacaaacac |
40082961 |
T |
|
| Q |
101 |
agcacaaataggaagaaactatagtatgagctataatggtc-----gtacagagtacggattccccttttgtttcccacattctctttactgtgtgtgta |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40082962 |
agcacaaataggaagaaactatagtatgaactataatggtcgtactgtacagagtacggattccccttttgtttcccacattctctttactgtgtgtgta |
40083061 |
T |
|
| Q |
196 |
ttcctcacttttcacattgcccttc |
220 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
40083062 |
ttcctcacttttcacattgcccttc |
40083086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University