View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6074_high_43 (Length: 224)
Name: NF6074_high_43
Description: NF6074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6074_high_43 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 23 - 224
Target Start/End: Original strand, 29969043 - 29969244
Alignment:
| Q |
23 |
caggaaagaactatcgccctgctaccagctctcggctagcatcagcctgcaagagagggatgatttgaggagctggttcgataaactccagccaaacatg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29969043 |
caggaaagaactatcgccctgctaccagctctcggctagcatcagcctgcaagagagggatgatttgaggaggtggttcgataaactccagccaaacatg |
29969142 |
T |
|
| Q |
123 |
gctaccagaagctttgtgctttgcaaaacaatccacaactgcatttccttctctaagctgatgcactagctggatggtctgattcttagctaataactcc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29969143 |
gctaccagaagctttgtgctttgcaaaacaatccacaactgcatttccttctctaagctgatgcactagctggatggtctgattcttagctaataactcc |
29969242 |
T |
|
| Q |
223 |
tt |
224 |
Q |
| |
|
|| |
|
|
| T |
29969243 |
tt |
29969244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 25 - 106
Target Start/End: Complemental strand, 45916070 - 45915989
Alignment:
| Q |
25 |
ggaaagaactatcgccctgctaccagctctcggctagcatcagcctgcaagagagggatgatttgaggagctggttcgataa |
106 |
Q |
| |
|
||||||||||| |||| |||||| |||||| |||||||||||| ||| || |||||||||| | | ||| ||||||||||| |
|
|
| T |
45916070 |
ggaaagaactaacgccttgctactagctcttggctagcatcagtctgtaaaagagggatgactccaagaggtggttcgataa |
45915989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University