View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6074_high_45 (Length: 220)
Name: NF6074_high_45
Description: NF6074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6074_high_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 32206072 - 32206261
Alignment:
| Q |
15 |
aatatatctatcattcatcttttagattttgatgcatatgacatgaaccaagtatagatttatataatggattgtagtcataattagcnnnnnnnntt-g |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
32206072 |
aatatatctatcattcatcttttagattttgatgcatatgacatgaaccaagtatagatttatataatggattgtagtcataattagcaaaaaaaatttg |
32206171 |
T |
|
| Q |
114 |
gtcgaattgctacggatgcaactcattctgcacgagggcgtaatatttagctgacaaagattagtcaaatttgtaagatgtgatgtaact |
203 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32206172 |
gtcgaattgctaaggatgcaactcattctgcacgagggcgtaatatttagctgacaaagattagtcaaatttgtaagatgtgatgtaact |
32206261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University