View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6074_low_17 (Length: 340)
Name: NF6074_low_17
Description: NF6074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6074_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 328
Target Start/End: Original strand, 47037092 - 47037403
Alignment:
| Q |
18 |
tattctttcacctgtctcgctcattctacatatcaacaactgcctcttttggtgcttatctcaatatccacttgtttttagcaaccgaatcaatgttaan |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47037092 |
tattctttcacctgtctcgctcattctacatatcaacaactgcctcttttggtgcttatctcaatatccacttgtttttagcaaccgaatcaatgttaaa |
47037191 |
T |
 |
| Q |
118 |
nnnnnnn-gtacgtttcaaactaatgccgctttgttgggccactgccgttcctatgaatcctatctttatctcttcgtcattcgttggcctcttttcaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47037192 |
ttttttttgtacgtttcaaactaatgccgctttgttgggccactgccgttcctatgaatcctatctttatctcttcgtcattcgttggcctcttttcaca |
47037291 |
T |
 |
| Q |
217 |
ttggttaattgcatttgcacatattttgatcaatcatcatcaagataacatagttcacaaaaaacgcaagtgtcttcnnnnnnncatattgctatagagt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
47037292 |
ttggttaattgcatttgcacatattttgatctatcatcatcaagataatatagttcacaaaaaacgcaagtgtcttaaaaaaaacatattgatatagagt |
47037391 |
T |
 |
| Q |
317 |
gattagaatgat |
328 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47037392 |
gattagaatgat |
47037403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University