View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6074_low_19 (Length: 336)
Name: NF6074_low_19
Description: NF6074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6074_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-175
Query Start/End: Original strand, 11 - 324
Target Start/End: Complemental strand, 655061 - 654748
Alignment:
| Q |
11 |
cacagaacacacaccgcttagatacttccacccccactaaccgtctctttgcaagattaaccttagtcggtaacctatcaaggaacaaggtccacgaaaa |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
655061 |
cacaaaacacacaccgcttagatacttccacccccactaaccgtctctttgcaagattaaccttagtcggtaacctatcaaggaacaaggtccacgaaaa |
654962 |
T |
 |
| Q |
111 |
agctagtacctttggaggagccttgctcttccaaagatcctggaacacaccctcctcctcataagacaaagcaccctccaaaagccacaaattttgaagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
654961 |
agctagtacctttggaggagccttgctcttccaaagatcctggaacacaccctcctcctcataagacaaagcaccctccaaaagccacaaattttgaagt |
654862 |
T |
 |
| Q |
211 |
aaagaataacaagacttgacggtaaacactccctccttttccggcttccaagaccatgtatccacacccttttatttcttttatgatgtagtattttacc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
654861 |
aaagaataacaagacttgacggtaaacactccctccttttccggcttccaagaccatgtatccacacccttttatttcttttatgatgtagtattttacc |
654762 |
T |
 |
| Q |
311 |
attataacaatttg |
324 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
654761 |
attataacaatttg |
654748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 13855371 - 13855239
Alignment:
| Q |
11 |
cacagaacacacaccgcttagatacttccacccccactaaccgtctctttgcaagattaaccttagtcggtaacctatcaaggaacaaggtccacgaaaa |
110 |
Q |
| |
|
|||| |||||||||| |||||| ||||||||| || || || |||||| |||| || ||| ||||||| | |||||| || || || ||||||||||| |
|
|
| T |
13855371 |
cacaaaacacacacctcttagaatcttccaccctcagtagccttctcttcccaaggttcaccatagtcgggatcctatctagaaataaagtccacgaaaa |
13855272 |
T |
 |
| Q |
111 |
agctagtacctttggaggagccttgctcttcca |
143 |
Q |
| |
|
||| | |||||||| || ||||| |||||||| |
|
|
| T |
13855271 |
agccaatacctttgccggcgccttactcttcca |
13855239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University