View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6074_low_34 (Length: 243)
Name: NF6074_low_34
Description: NF6074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6074_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 32206035 - 32206261
Alignment:
| Q |
1 |
tgataatggatacaataaggtatgtacatctcttcaaaatatatctatcattcatcttttagattttgatgcatatgacatgaaccaagtatagatttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32206035 |
tgataatggatacaataaggtatgtatatctcttcaaaatatatctatcattcatcttttagattttgatgcatatgacatgaaccaagtatagatttat |
32206134 |
T |
|
| Q |
101 |
ataatggattgtagtcataattagc-nnnnnnnnttggtcgaattgctacggatgcaactcattctgcacgagggcgtaatatttagctgacaaagatta |
199 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32206135 |
ataatggattgtagtcataattagcaaaaaaaatttggtcgaattgctaaggatgcaactcattctgcacgagggcgtaatatttagctgacaaagatta |
32206234 |
T |
|
| Q |
200 |
gtcaaatttgtaagatgtgatgtaact |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32206235 |
gtcaaatttgtaagatgtgatgtaact |
32206261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University