View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6074_low_36 (Length: 241)

Name: NF6074_low_36
Description: NF6074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6074_low_36
NF6074_low_36
[»] chr5 (1 HSPs)
chr5 (1-213)||(40082381-40082593)


Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 40082593 - 40082381
Alignment:
1 ctttcatttttagtttcaaaaccatacatagnnnnnnnnnnnnttacaacaaagttcattttttgaatttaataaaacaaagttcattttatatgttgga 100  Q
    |||||||||||||||||||||||||||||||            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40082593 ctttcatttttagtttcaaaaccatacatagaaaaaacaaaaattacaacaaagttcattttttgaatttaataaaacaaagttcattttatatgttgga 40082494  T
101 accccaataaattaacatgtcatgaaaaaatcatcatcccttttttcttttctttgcagtcctcaaataatattatgtggtcactccactagttatgtag 200  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
40082493 actccaataaattaacatgtcatgaaaaaatcatcatcccttttttcttttctttgcagtcctcaaataatattatgtcgtcactccactagttatgtag 40082394  T
201 gatattactattc 213  Q
    |||||||||||||    
40082393 gatattactattc 40082381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University