View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6074_low_45 (Length: 221)
Name: NF6074_low_45
Description: NF6074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6074_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 3466994 - 3467206
Alignment:
| Q |
1 |
ctagttgctacaattcctttgcttagactttggtttcgctttatgcgtccgcgaacaatgaacaccatccttggtacaggatcaccttctctaattatct |
100 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3466994 |
ctagtcgcgacaatgcctttgcttagactttggtttcgctttatgcgtccgcgaacaatgaacaccatccttggtacaggatcaccttctctaattatct |
3467093 |
T |
 |
| Q |
101 |
gtttcacaaggatatatatgaaagaatt-aaaaaccatgatggaaattttgaagtcctttttcaaagaattaaaaagtttatatgattaatcatataatc |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3467094 |
gtttcacaaggatatatatgtaagaattaaaaaaccatgatggacattttgaagtcctttttcaaagaattaaaaagtttatatgatt----atataatc |
3467189 |
T |
 |
| Q |
200 |
aataccttttcatctct |
216 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3467190 |
aataccttttcatctct |
3467206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University