View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6074_low_46 (Length: 220)

Name: NF6074_low_46
Description: NF6074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6074_low_46
NF6074_low_46
[»] chr2 (1 HSPs)
chr2 (15-203)||(32206072-32206261)


Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 32206072 - 32206261
Alignment:
15 aatatatctatcattcatcttttagattttgatgcatatgacatgaaccaagtatagatttatataatggattgtagtcataattagcnnnnnnnntt-g 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        || |    
32206072 aatatatctatcattcatcttttagattttgatgcatatgacatgaaccaagtatagatttatataatggattgtagtcataattagcaaaaaaaatttg 32206171  T
114 gtcgaattgctacggatgcaactcattctgcacgagggcgtaatatttagctgacaaagattagtcaaatttgtaagatgtgatgtaact 203  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32206172 gtcgaattgctaaggatgcaactcattctgcacgagggcgtaatatttagctgacaaagattagtcaaatttgtaagatgtgatgtaact 32206261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University