View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_114 (Length: 272)
Name: NF6076_high_114
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_114 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 90 - 257
Target Start/End: Complemental strand, 2234163 - 2233996
Alignment:
| Q |
90 |
gcatcaagggctggcctaagagtaaggttactaaagtctaagctttaagcctaccaacaaaagtaaactcatcatattttataaatgaaaagaccacata |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2234163 |
gcatcaagggctggcctaagagtaaggttactaaagtctaagctttaagcctaccaacaaaagtaaactcatcatattttataaatgaaaagaccacata |
2234064 |
T |
 |
| Q |
190 |
tatatgcagacaaaaaatcgcatatattaaaacttgttttatgcatcacttactgaaaattattaagt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2234063 |
tatatgcagacaaaaaatcgcatatattaaaacttgttttatgcatcacttactgaaaattattaagt |
2233996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University