View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_136 (Length: 251)
Name: NF6076_high_136
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_136 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 5656106 - 5656348
Alignment:
| Q |
1 |
tctaaccttctgcatgaattcatttgatccttgacaaacttcccagtttatttcagcctcattttctcttccaaattcatcactacctccacatgatcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5656106 |
tctaaccttctgcatgaattcatttgatccttgacaaacttcccagtttatttcagcctcattttctcttccaaattcatcactacctccacatgatcct |
5656205 |
T |
 |
| Q |
101 |
aatagtgttgatgaagttgannnnnnngatgaaatattgctcatgtagctagtgaaagcaaatcttgaccatccattttctatagcatcagaagctaggt |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5656206 |
aatagtgttgatgaagttgatttttttgatgaaatattactcatgtagctagtgaaagcaaatcttgaccatccattttctatagcatcagaagctagat |
5656305 |
T |
 |
| Q |
201 |
atggatgatcattccaactgaacaaatcttttcttcctttgct |
243 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5656306 |
atggatgatcattccagttgaacaaatcttttcttcctttgct |
5656348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 146 - 191
Target Start/End: Complemental strand, 47047714 - 47047669
Alignment:
| Q |
146 |
tagctagtgaaagcaaatcttgaccatccattttctatagcatcag |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
47047714 |
tagctagtgaaagcaaatcttgaccatccattttcaacagcatcag |
47047669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University