View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_137 (Length: 250)
Name: NF6076_high_137
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_137 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 11 - 178
Target Start/End: Original strand, 25892177 - 25892351
Alignment:
| Q |
11 |
cacagaaataagtatgtaatctgctaaataaaaagacataagtaagtaatgtaatggaccatgaccagtatcattaatttcattgtcattttgcaatgaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25892177 |
cacagaaataagtatgtaatctgctaaataaaaagacataagtaagtaatgtaatggaccatgaccagtatcattaatttcattgtcattttgcaatgaa |
25892276 |
T |
 |
| Q |
111 |
tggca-------aaaggacaaactattattcatttgttagaagaactttaagaatacattctctttctgtcccct |
178 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25892277 |
tggcaaaaggacaaaggacaaactattatttatttgttagaagaactttaagaatatcttctctttctgtcccct |
25892351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 25892376 - 25892424
Alignment:
| Q |
202 |
ttctcttgctacatgctatatatatctctcagaccctgaaagaagaaaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
25892376 |
ttctcttgctacatgctatatatatctctccgactctgaaagaagaaaa |
25892424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University