View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_148 (Length: 243)
Name: NF6076_high_148
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_148 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 243
Target Start/End: Original strand, 48917961 - 48918192
Alignment:
| Q |
12 |
catcatcagccaagaaagggagaggaagaaacacttttcccataggattagcccaaggaactcttttagaatcaccaccagcatgaagcaatagaacatg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48917961 |
catcatcagccaagaaagggagaggaagaaaaactttccccataggattagcccaaggaactcttttagaatcaccaccagcatgaagcaatagaacatg |
48918060 |
T |
 |
| Q |
112 |
tttacaagcaagcaaattggaagcagaggtaccataatgaagagaaagggagtggagagcattgagagtggcggcaccggagccaatacggcagccgaga |
211 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48918061 |
tttacaagcaagcacattggaagcagaggtaccataatgaagagaaagggagtggagagcattgagagtggcggcaccggagccaatacggcggccgaga |
48918160 |
T |
 |
| Q |
212 |
ggatcagggacagcgagagtgagtgttgatgg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48918161 |
ggatcagggacagcgagagtgagtgttgatgg |
48918192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University