View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_153 (Length: 243)
Name: NF6076_high_153
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_153 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 35809048 - 35808823
Alignment:
| Q |
18 |
cctttaaatagcaacaattcactaaaatataccaatagtgagaaccatacatttatcatcactaaaactaaagatagagagcactctagagaaatcatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35809048 |
cctttaaatagcaacaattcactaaaatataccaatagtgagaaccatacatttatcatcactaaaactaaagatagagagcactctagagaaatcatga |
35808949 |
T |
 |
| Q |
118 |
agggttatgaaccaaggtcaagttcctcttgtgcagcctgcaaatttctgaaaagaagatgcataccaaattgtatatttgcgccatactttcgctccga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808948 |
agggttatgaaccaaggtcaagttcctcttgtgcagcctgcaaatttctgaaaagaagatgcataccaaattgtatatttgcgccatactttcgctccga |
35808849 |
T |
 |
| Q |
218 |
tgagtgcaagaaattcgcgaaagttc |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35808848 |
tgagtgcaagaaattcgcgaaagttc |
35808823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 117 - 243
Target Start/End: Complemental strand, 32036582 - 32036456
Alignment:
| Q |
117 |
aagggttatgaaccaaggtcaagttcctcttgtgcagcctgcaaatttctgaaaagaagatgcataccaaattgtatatttgcgccatactttcgctccg |
216 |
Q |
| |
|
||||||||||| ||| | ||||| || ||||||||||| |||||||| ||||||||||||||| |||| |||| ||||||| || ||||| | || |
|
|
| T |
32036582 |
aagggttatgagccacgttcaagctcatcttgtgcagcttgcaaattattgaaaagaagatgcacaccagattgcttatttgcaccttacttccattcta |
32036483 |
T |
 |
| Q |
217 |
atgagtgcaagaaattcgcgaaagttc |
243 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
32036482 |
atgagtgcaagaaattcgccaaagttc |
32036456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University