View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_160 (Length: 241)
Name: NF6076_high_160
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_160 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 7 - 222
Target Start/End: Complemental strand, 22611903 - 22611688
Alignment:
| Q |
7 |
tcttaatcattatcctgagagcatcggttaaccatacatgtggtctattaatcttattcaaatgctaatgttatatgaatattataaagttagacaaatg |
106 |
Q |
| |
|
|||||||||||||||||| ||| ||||| ||||||| || || |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22611903 |
tcttaatcattatcctgaaggcaccggttgaccatacccgtagtttattaatcttattcaaatcctaatgttatatgaatattataaagttagacaaatg |
22611804 |
T |
 |
| Q |
107 |
attgttaatcgaatctaaacggatctgcataatctaaaccctttcaatttggtgaatatctatgcgttagactagctcaacacctacacatctctcaatt |
206 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22611803 |
attgttaatcgaatctaaacggatctggataatctaaaccctttcaatttggtgaatatctatgcgttagaccagctcaacacctacacatctctcaatt |
22611704 |
T |
 |
| Q |
207 |
aaaattctaaaggacg |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
22611703 |
aaaattctaaaggacg |
22611688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University